Posted: March 1st, 2017

When designing primers, it is ideal to have a minimum GC content of 40%

When designing primers, it is ideal to have a minimum GC content of 40%.

What is the percent of GC content for each of the primers designed in Data Table 4? Are the primers considered “ideal” in terms of GC content? Explain your answer. Table 4 Primer 1: TAGCTCAAAGGGTACCTCAG Primer 2: GATTGGAAGGAACTTCTA